8 softwares de bioinformática de acesso gratuito

Pensando em Fazer Ciência do sofá de casa?

Atualmente, os dados gerados pelos inúmeros projetos de genomas estão disponíveis online e com livre acesso. Podemos destacar três  bancos de dados que são atualizados diariamente:

  • No Japão, a Enciclopédia de Genes e Genomas de Kyoto (a KEGG, da sigla em inglês, Kyoto Encyclopedia of Genes and Genomes) é um projeto com diferentes repositórios de informação biológica, mas vale destacar a excelente ferramenta de mapas metabólicos.
  • O banco de dados de proteínas suíço, UniProt (do inglês,  Universal Protein Resource), em tradução livre “Recurso Universal de Proteínas”, dispõe de excelentes ferramentas de anotações de sequência de proteínas e estruturas 3D.
  • Por último, mas não menos importante, localizado nos Estados Unidos está o Centro Nacional de Informação Biotecnológica, o NCBI (National Center for Biotechnology Information). Podemos sugeri-lo como um dos melhores repositório de sequências de DNA e RNA.

É importante mencionar que os três bancos de dados são projetos mantidos por iniciativas públicas em diferentes países. Eles apresentam um conjunto de dados e ferramentas de análises biológicas bem variadas, desde dados de expressão gênica a informações filogenéticas.   

Exemplificação de como ocorre o fluxo de informações do código genético e relaciona com os banco de dados. Imagem editada pelo autor.

Pensando de forma lúdica, as informações mantidas nesses bancos de dados são como um manual de instruções de como construir um organismo. De posse dessas ferramentas, o cientista interessado em engenharia genética pode iniciar seu projeto de organismo geneticamente modificado (OGM), construção de uma proteína, ou ainda, um plasmídeo para terapia gênica. A abundância de produtos biotecnológicos que podem ser criados é incalculável.

Os bancos citados são uma iniciativa global e estão disponíveis para serem usadas em prol da vida e, para tanto, existem muitos softwares de bioinformática  utilizados para gerir esses dados. Rejeitada a percepção popular de que a ciência só é feita em laboratórios universitários, governamentais ou corporativos de milhões de dólares, apresentamos uma pequena compilação de 8 programas de bioinformática, compatíveis com o sistema operacional Windows e de acesso gratuito.

“Assim como um Engenheiro Civil planeja, desenha e projeta edifícios e pontes a partir de softwares de informática, um Biotecnologista interessado em “Engenharia Genética” planeja, desenha e projeta organismos vivos editando seus códigos genéticos a partir de softwares de Bioinformática”.

1. Gegenees

É um software que compara as sequências do genoma. Foi desenvolvido principalmente para genomas bacterianos (procariotos), mas também é possível usar em vírus e eucariotos. Esse programa fragmenta os genomas em análise e compara todas as partes obtidas com todos os genomas disponíveis no banco de dados. Com base na comparação, dados filogenéticos podem ser gerados, sendo também possível definir grupos-alvo e buscar regiões genômicas com alto grau de especificidade (assinaturas genômicas). As regiões de assinatura genômica podem ser usadas para o desenho de primers ou sondas para ensaios de diagnóstico genético.

Link de acesso para baixar o programa: http://www.gegenees.org/

2. Unipro UGENE

Unipro UGENE é um software de código aberto com o objetivo principal de auxiliar cientistas moleculares sem muita experiência em Bioinformática a gerenciar, analisar e visualizar seus dados. O kit de ferramentas suporta vários formatos de dados biológicos e permite a recuperação de dados usando os seguintes bancos online: ENSEMBL, NCBI, UNIPROT, EBI, KEGG.  

Link de acesso para baixar o programa: http://ugene.net/   

3. SEQtools

É uma grande coleção de ferramentas para análises básicas e avançadas de sequências de nucleotídeos. O software pode gerenciar milhares de sequências fazendo análises e pesquisas em banco de dados online.

Link de acesso para baixar o programa: SEQtools

4. DNAClub

O DNAClub é um software de edição de sequências. Os recursos incluem a remoção de vetores, promotores e/ou partes constituintes, busca por ORFs (do inglês, open reading frames), edição e tradução de sequências de DNA em sequências de aminoácidos e vice-versa, seleção de primers para PCR, avaliação de sondas, entre outros.

Link de acesso para baixar o programa: DNAClub

5. BioEdit

O BioEdit é um editor de sequências desenvolvido e escrito por um estudante de pós-graduação. O programa destina-se a fornecer inúmeras funções em um único local, permitindo desde ações simples, como a edição e manipulação de sequências, até comparações em múltiplos alinhamentos.

Link de acesso para baixar o programa: BioEdit

6. Seqool

É um software de análise de sequência, projetado principalmente para pesquisar sinais biológicos em sequências de ácidos nucleicos, fornecendo vários modelos de reconhecimento de padrões. Os modelos podem ser combinados usando, por exemplo, árvores de decisão ou redes neurais. Também inclui as análises estatísticas de sequências mais comuns, como conteúdo de GC, uso de códons ou sítios específicos de splice.

Link de acesso para baixar o programa: Seqool

7. RNAstructure

RNAstructure é um software completo para a análise da estrutura secundária de RNA e DNA. Ele inclui comandos para prever probabilidades de emparelhamento de bases e também pode ser usado para predizer estruturas biomoleculares e a afinidade de ligação entre oligonucleótidos a um alvo de RNA estruturado. Isso é útil para o design de siRNA  (do inglês: small interfering RNA), moléculas envolvidas em um mecanismo de controle da expressão gênica.

Link de acesso para baixar o programa : RNAstructure

8. RNAdraw

RNAdraw é um programa para desenhar RNAs. Com recursos de edição de bases, é possível  monitorar de forma interativa mudanças de estrutura e energia de acordo com a sequência inserida. Um RNA personalizado pode ser criado pelo usuário e salvo em uma biblioteca própria do programa.

Link de acesso para baixar o programa: RNAdraw

ATCGTCAGTCGATGACTGCAGCTAG Charge traduzida, para a original, link na imagem.

O software livre e o código aberto permitem aos engenheiros de software acessarem o código-fonte usado para criar os programas de computador. Assim como o livre acesso ao código-fonte da vida (DNA) permite aos pesquisadores produzir biotecnologias que visam melhorar a maneira como nós interagimos e compreendemos o mundo. Esse preceito traz consigo grandes responsabilidades, mas, olhando para os últimos 60 anos desde a descoberta da molécula de DNA, enquanto humanidade, nós fomos capazes de criar coisas incríveis em prol da vida.

O conhecimento do passado e as inovações do presente, nos permitem criar ainda mais.

3 comentários em “8 softwares de bioinformática de acesso gratuito

Os comentários estão encerrados.